Review



crl 1573 oligonucleotides crrna  (ATCC)


Bioz Verified Symbol ATCC is a verified supplier
Bioz Manufacturer Symbol ATCC manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 99
      Buy from Supplier

    Structured Review

    ATCC crl 1573 oligonucleotides crrna
    Crl 1573 Oligonucleotides Crrna, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 22361 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/crl+1573+oligonucleotides+crrna/293/pm41863805-169-111-108
    Average 99 stars, based on 22361 article reviews
    crl 1573 oligonucleotides crrna - by Bioz Stars, 2026-09
    99/100 stars

    Images

    Related Articles

    Membrane:

    Article Title: Autoinhibitory control of MLKL governs pseudokinase domain phosphorylation and oligomerization during necroptosis.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER 4–20% Mini-PROTEAN® TGXTM Precast Protein Gels, 15-well, 15 μL Bio-Rad Laboratories Cat# 4561096 PVDF Transfer Membranes, 0.45 μm Thermo Scientific Cat# 88518 Nitrocellulose Membrane, Roll, 0.45 μm Bio-Rad Laboratories Cat# 1620115 Nitrocellulose Membrane, Roll, 0.22 μm Bio-Rad Laboratories Cat# 1620112 PierceTM Anti-HA Magnetic Beads Thermo Scientific Cat# 88836 PierceTM Anti-c-Myc Magnetic Beads Thermo Scientific Cat# 88842 Propidium iodide Invitrogen Cat# P3566 Critical commercial assays Cell Line Nucleofector Kit R Lonza Cat# VCA-1001 Bio-Rad Protein Assay Dye Reagent Concentrate Bio-Rad Laboratories Cat# 5000006 Experimental models: Cell lines HT-29 ATCC Cat# HTB-38 MLKL− /− HT-29 This paper N/A RIPK3− /− HT-29 This paper N/A HEK293T ATCC Cat #: CRL-1573 Oligonucleotides crRNA targeting human MLKL: CACACCGTTTGTGGATGACC Integrated DNA Technologies (IDT) Cat# Hs.Cas9.MLKL.1.AA crRNA targeting human MLKL: TACTCTTCAAGGACGTGAAC Integrated DNA Technologies (IDT) Cat# Hs.Cas9.MLKL.1.AE crRNA targeting human RIPK3: CCGGGCGCAACATAGGAAGT Integrated DNA Technologies (IDT) Cat# Hs.Cas9.RIPK3.1.AC Recombinant DNA pMD2.G Addgene Cat# 12259 psPAX2 Addgene Cat# 12260 Monobody 33 Thermo GeneArt Petrie et al.29 Software and algorithms Prism 10 GraphPad N/A Pymol2 Schrodinger N/A AlphaFold3 Google DeepMind Abramson et al.34 ICE (Inference of CRISPREdits) Synthego N/A 14 Cell Reports 45, 117130, April 28, 2026 ..

    Magnetic Beads:

    Article Title: Autoinhibitory control of MLKL governs pseudokinase domain phosphorylation and oligomerization during necroptosis.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER 4–20% Mini-PROTEAN® TGXTM Precast Protein Gels, 15-well, 15 μL Bio-Rad Laboratories Cat# 4561096 PVDF Transfer Membranes, 0.45 μm Thermo Scientific Cat# 88518 Nitrocellulose Membrane, Roll, 0.45 μm Bio-Rad Laboratories Cat# 1620115 Nitrocellulose Membrane, Roll, 0.22 μm Bio-Rad Laboratories Cat# 1620112 PierceTM Anti-HA Magnetic Beads Thermo Scientific Cat# 88836 PierceTM Anti-c-Myc Magnetic Beads Thermo Scientific Cat# 88842 Propidium iodide Invitrogen Cat# P3566 Critical commercial assays Cell Line Nucleofector Kit R Lonza Cat# VCA-1001 Bio-Rad Protein Assay Dye Reagent Concentrate Bio-Rad Laboratories Cat# 5000006 Experimental models: Cell lines HT-29 ATCC Cat# HTB-38 MLKL− /− HT-29 This paper N/A RIPK3− /− HT-29 This paper N/A HEK293T ATCC Cat #: CRL-1573 Oligonucleotides crRNA targeting human MLKL: CACACCGTTTGTGGATGACC Integrated DNA Technologies (IDT) Cat# Hs.Cas9.MLKL.1.AA crRNA targeting human MLKL: TACTCTTCAAGGACGTGAAC Integrated DNA Technologies (IDT) Cat# Hs.Cas9.MLKL.1.AE crRNA targeting human RIPK3: CCGGGCGCAACATAGGAAGT Integrated DNA Technologies (IDT) Cat# Hs.Cas9.RIPK3.1.AC Recombinant DNA pMD2.G Addgene Cat# 12259 psPAX2 Addgene Cat# 12260 Monobody 33 Thermo GeneArt Petrie et al.29 Software and algorithms Prism 10 GraphPad N/A Pymol2 Schrodinger N/A AlphaFold3 Google DeepMind Abramson et al.34 ICE (Inference of CRISPREdits) Synthego N/A 14 Cell Reports 45, 117130, April 28, 2026 ..

    Recombinant:

    Article Title: Autoinhibitory control of MLKL governs pseudokinase domain phosphorylation and oligomerization during necroptosis.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER 4–20% Mini-PROTEAN® TGXTM Precast Protein Gels, 15-well, 15 μL Bio-Rad Laboratories Cat# 4561096 PVDF Transfer Membranes, 0.45 μm Thermo Scientific Cat# 88518 Nitrocellulose Membrane, Roll, 0.45 μm Bio-Rad Laboratories Cat# 1620115 Nitrocellulose Membrane, Roll, 0.22 μm Bio-Rad Laboratories Cat# 1620112 PierceTM Anti-HA Magnetic Beads Thermo Scientific Cat# 88836 PierceTM Anti-c-Myc Magnetic Beads Thermo Scientific Cat# 88842 Propidium iodide Invitrogen Cat# P3566 Critical commercial assays Cell Line Nucleofector Kit R Lonza Cat# VCA-1001 Bio-Rad Protein Assay Dye Reagent Concentrate Bio-Rad Laboratories Cat# 5000006 Experimental models: Cell lines HT-29 ATCC Cat# HTB-38 MLKL− /− HT-29 This paper N/A RIPK3− /− HT-29 This paper N/A HEK293T ATCC Cat #: CRL-1573 Oligonucleotides crRNA targeting human MLKL: CACACCGTTTGTGGATGACC Integrated DNA Technologies (IDT) Cat# Hs.Cas9.MLKL.1.AA crRNA targeting human MLKL: TACTCTTCAAGGACGTGAAC Integrated DNA Technologies (IDT) Cat# Hs.Cas9.MLKL.1.AE crRNA targeting human RIPK3: CCGGGCGCAACATAGGAAGT Integrated DNA Technologies (IDT) Cat# Hs.Cas9.RIPK3.1.AC Recombinant DNA pMD2.G Addgene Cat# 12259 psPAX2 Addgene Cat# 12260 Monobody 33 Thermo GeneArt Petrie et al.29 Software and algorithms Prism 10 GraphPad N/A Pymol2 Schrodinger N/A AlphaFold3 Google DeepMind Abramson et al.34 ICE (Inference of CRISPREdits) Synthego N/A 14 Cell Reports 45, 117130, April 28, 2026 ..

    Software:

    Article Title: Autoinhibitory control of MLKL governs pseudokinase domain phosphorylation and oligomerization during necroptosis.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER 4–20% Mini-PROTEAN® TGXTM Precast Protein Gels, 15-well, 15 μL Bio-Rad Laboratories Cat# 4561096 PVDF Transfer Membranes, 0.45 μm Thermo Scientific Cat# 88518 Nitrocellulose Membrane, Roll, 0.45 μm Bio-Rad Laboratories Cat# 1620115 Nitrocellulose Membrane, Roll, 0.22 μm Bio-Rad Laboratories Cat# 1620112 PierceTM Anti-HA Magnetic Beads Thermo Scientific Cat# 88836 PierceTM Anti-c-Myc Magnetic Beads Thermo Scientific Cat# 88842 Propidium iodide Invitrogen Cat# P3566 Critical commercial assays Cell Line Nucleofector Kit R Lonza Cat# VCA-1001 Bio-Rad Protein Assay Dye Reagent Concentrate Bio-Rad Laboratories Cat# 5000006 Experimental models: Cell lines HT-29 ATCC Cat# HTB-38 MLKL− /− HT-29 This paper N/A RIPK3− /− HT-29 This paper N/A HEK293T ATCC Cat #: CRL-1573 Oligonucleotides crRNA targeting human MLKL: CACACCGTTTGTGGATGACC Integrated DNA Technologies (IDT) Cat# Hs.Cas9.MLKL.1.AA crRNA targeting human MLKL: TACTCTTCAAGGACGTGAAC Integrated DNA Technologies (IDT) Cat# Hs.Cas9.MLKL.1.AE crRNA targeting human RIPK3: CCGGGCGCAACATAGGAAGT Integrated DNA Technologies (IDT) Cat# Hs.Cas9.RIPK3.1.AC Recombinant DNA pMD2.G Addgene Cat# 12259 psPAX2 Addgene Cat# 12260 Monobody 33 Thermo GeneArt Petrie et al.29 Software and algorithms Prism 10 GraphPad N/A Pymol2 Schrodinger N/A AlphaFold3 Google DeepMind Abramson et al.34 ICE (Inference of CRISPREdits) Synthego N/A 14 Cell Reports 45, 117130, April 28, 2026 ..



    Similar Products

    crl 1573 oligonucleotides crrna  (ATCC)
    99
    ATCC crl 1573 oligonucleotides crrna
    Crl 1573 Oligonucleotides Crrna, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/crl+1573+oligonucleotides+crrna/293/pm41863805-169-111-108
    Average 99 stars, based on 1 article reviews
    crl 1573 oligonucleotides crrna - by Bioz Stars, 2026-09
    99/100 stars
    		  Buy from Supplier

    Image Search Results